Two hours after injection of 0.2 ml of the prepared 99mTc-HYNIC annexin (4-8 MBq), whole body planar imaging was performed on tumor bearing mice which had received different single-doses of radiation. As shown in Figures 2 and 3, without radiation (0 Gy), the radioactivity uptake in EL4 lymphoma and S180 sarcoma was GSK458 purchase similar to that of the background; the tumors were not clearly

shown in99mTc-HYNIC-annexinV imaging. Moreover, the images in control animals (0 Gy) demonstrated a high concentration of radio-labelled annexin V in the heart and bladder, with a lesser distribution in other organs (Figures 2A and 3A). The tracer uptake shows accumulation in the head and neck and thymus region in EL4 lymphoma irradiated with 4 Gy and 8 Gy (Figures 2C and 2D). The increased density of tracer in the tail (Figures 2A and 3B) was due to the tracer at Selleckchem MLN0128 the site of injection. The liver and kidneys were not visualized as separate structures. It demonstrated

(Figures 2B to 2D) that for EL4 lymphoma, as the radiation dose was escalated from 2 to 4 and 8 Gy, there was a marked increase in tumor uptake of99mTc-HYNIC annexin V. The irradiated tumor image became clearer. However, in S180 sarcoma bearing mice, even with 8 Gy irradiation, the tumor uptake of99mTc-HYNIC- annexin V was similar to that of the background; and the tumor was not clearly shown in imaging. The99mTc-HYNIC- annexin V uptake concentration was high in bladder, liver and kidney. Figure 2 Representative 99m Tc-HYNIC-annexin V scintigraphy (TAVS) images of EL4 lymphoma bearing mice treated with irradiation. Mice were injected 4-8 MBq radiolabeled annexin V 24 hours post-radiation and imaged 2 h later. The images Erastin supplier show increased annexin V uptake in tumor as radiation dose increased. The white arrow indicates the implanted tumor. A: 0 Gy; B:2 Gy; C:4 Gy; D:8 Gy. Figure 3 Annexin V imaging of S180 sarcoma bearing mice treated with

irradiation. The images show insignificant annexin V uptake in tumor with radiation dose of 8 Gy comparing to 0 Gy control. The white arrow indicates the implanted tumor. A: 0 Gy; B:8 Gy. Biodistribution of99mTc-HYNIC- annexin V and tumor apoptosis after irradiation The control and irradiated mice were sacrificed immediately after99mTc-HYNIC-annexin V imaging. Biodistribution assays were performed with a well-type γ-counter. The radioactivity parameters measured (T/M and T/B ratios) are shown in Tables 2 and 3. Table 2 Biodistribution of99mTc-HYNIC-Annexin-V in EL4 lymphoma and the number of apoptotic cells after single-dose irradiations     Dose (Gy)     p     0 2 4 8 0 vs.2 2 vs.4 4 vs.8 %ID/g 0.160 ± 0.013 0.272 ± 0.021 0.312 ± 0.020 0.355 ± 0.025 <0.001 0.017 0.009 T/B 0.729 ± 0.037 1.252 ± 0.086 1.396 ± 0.021 1.661 ± 0.072 <0.001 0.005 <0.001 T/M 2.575 ± 0.154 4.522 ± 0.554 5.191 ± 0.511 7.138 ± 0.266 <0.001 0.039 <0.001 Apoptotic cells 1.405 ± 0.191 2.459 ± 0.370 4.364 ± 0.778 6.

Generally, based on the well-accepted conductive filament hypothesis to explain the memory functional performance, several nanometer-sized filaments are indeed found in the so-called forming process. However, the conductive filament model could not clarify AZD4547 the origin of energy. Recently, the random circuit breaker network model [2, 3] and conical shape filament model [4, 5] are differently developed to emphasize joule heat contribution

on breaker and thermochemical-type resistance switching, respectively. The long switching time and large power consumption of RESET (transition from a low resistance state (LRS) to a high resistance state (HRS)) process need improvements [6]. Therefore, it is important to understand the joule heat generation in resistive switching RESET behavior for the fundamental understanding. A general thermal chemical reaction (TCR) model for the RESET process has been studied by calculating the filament temperature [7]. However, we found that only the TCR itself could not explain the whole RESET process,

especially for the RESET behaviors at different temperatures. In this work, we investigated the RESET process of NbAlO-based resistive switching DZNeP concentration memory device in detail at low temperatures and clarified the involved charge trapping effect. Methods A NbAlO film (10 nm) was fabricated on a Pt/SiO2/Si substrate via atomic layer deposition (ALD) at 300°C using Al(CH3)3 and Nb(OC2H5)5 as the precursor and H2O as the oxygen source. After deposition, the sample was post-annealed in O2 ambient at 400°C for 10 min. The TiN top electrodes with the diameter of Galeterone 100 μm were fabricated by reactive magnetron sputtering. Chemical bonding state and the microstructure of the NbAlO layer was measured through X-ray photoelectron spectroscopy (XPS) and

transmission electron microscopy (TEM), respectively. The compositions of NbAlO were 1:2:5.5, as confirmed through Rutherford backscattering methods. The samples were placed on a cryogenic Lakeshore probe station (Lake Shore Cryotronics, Inc., Westerville, USA) and cooled with nitrogen liquid. The electrical characteristics were measured at increasing temperatures from 80 to 200 K in an interval of 10 K using a Keithley 4200-SCS semiconductor parameter analyzer (Keithley Instruments Inc., Ohio, USA) with the voltage applied on top electrode of TiN while the bottom Pt electrode was grounded. Because of the overshoot phenomenon with a small current compliance [8], 5 mA was chosen as the current compliance to protect the samples from electrical breakdown during the SET (transition from HRS to LRS) process.

In many pathogens CPS has been found to be involved in evasion of the host immune system by circumvention of phagocytosis, opsonization and complement killing [15–17]. The aim of this study was to investigate in vitro differences in host response during infection with a wild type and an isogenic non-encapsulated mutant of a naturally encapsulated strain. The well-studied K1 serotype W83 strain was used as the wild type strain since its CPS biosynthesis locus has been described [18, 19]. An insertional mutation in PG0120 (epsC) was constructed, which yielded a non-encapsulated Proteases inhibitor strain. The gene has been annotated as a UDP-GlcNAc 2-epimerase.

This epsC mutant is tested in a fibroblast infection model [20] since fibroblasts are the most abundant stromal cells in soft connective tissue of the gingiva [21] and among the first cells encountering periodontal infections by anaerobic

bacteria like P. gingivalis. And above all, fibroblasts have been shown to be involved in the immune response in periodontitis [22, 23]. Human gingival fibroblasts were infected with W83 and the epsC mutant and transcription of IL-1β, IL-6 and IL-8 was determined as host response parameters. p38 inhibitors clinical trials This study provides the first direct evidence that P. gingivalis CPS reduces the host immune response, thereby potentially enabling evasion of the immune system to sustain successful long-term infection. Results EpsC mutant construction After

transformation of the linearized plasmid pΔEpsC to P. gingivalis W83 the epsC insertional mutation was confirmed by specific PCR amplifications and agarose gel electrophoresis of the products (data not shown). Primer combinations epsC BamHI F × PG0119 R and EryF F × epsC EcoRI R (Table 1) ensured that a 1.2 Kb fragment of Dichloromethane dehalogenase pΔEpsC had been integrated by double crossover at PG0120 (epsC) as expected, replacing the intact copy with the insertionally inactivated copy (Figure 1). Table 1 Primers used in this study Target Name Sequence (5′-3′) epsC epsC BamHI F ATATAGGATCCATGAAAAAAGTGATGTTGGTC   epsC EcoRI R CTATGAATTCATCTTCGGCTAAATGCATCG   epsC AscI F GAATATAGGCGCGCCATGAAAAAAGTGATGTTGGTC   epsC SpeI CTATACTAGTATCTTCGGCTAAATGCATCG eryF eryF ClaI F CCACCATCGATCGATAGCTTCCGCTATTGC   eryF ClaI R CCACCATCGATGTTTCCGCTCCATCGCCAATTTGC CP25 CP25 ClaI F GCCATATCGATGCATGCGGATCCCATTATG   CP25 AscI R CCTTTAGGCGCGCCCTTAATTTCTCCTC IL-6 IL-6 F GGCACTGGCAGAAAACAACC   IL-6 R GGCAAGTCTCCTCATTGAATCC IL-8 IL-8 F GGCAGCCTTCCTGATTTCTG   IL-8 R CTGACACATCTAAGTTCTTCTTTAGCACTCCTT IL-1β IL-1β F AAGATTCAGGTTTACTCACGTC   IL-1β R TGATGCTGCTTACATGTCTCG hup-1 hup-1 F GAAAAGGCCAACCTCACAAA   hup-1 F TCCGATGAGAGCGATTTTCT glk glk F ATGAATCCGATCCGCCACCAC   glk R GCCTCCCATCCCAAAGCACT In bold: restriction sites used in this study Figure 1 Schematic representation of the knockout strategy to construct the epsC insertional mutation in W83. A.

The representative images were shown (×200). To test the side effect induced by these adenoviruses, we injected Ad-EGFP, Ad-TRAIL and Ad-TRAIL-MRE-1-133-218 into BALB/c mice. On day 11, their blood was collected and assayed for ALT level in serum. Ad-TRAIL treatment was found to cause an elevated level of serum ALT in mice. In contrast, Ad-TRAIL-MRE-1-133-218 did not significantly change the ALT level in the blood of mice, showing no cytotoxicity to liver cells (Figure 4c). Also, TRAIL expression was evaluated in the tumor and liver sections from the T24 tumor-bearing

mice that received the injection of Ad-EGFP, Ad-TRAIL and Ad-TRAIL-MRE-1-133-218. The histological staining showed that Selleckchem APO866 Ad-TRAIL-MRE-1-133-218 treatment resulted in high expression of TRAIL in tumors as Ad-TRAIL infection (Figure 4d). Importantly, TRAIL expression was not detected in

liver section from Ad-TRAIL-MRE-1-133-218-treated group, whereas Ad-TRAIL-infected mice had an extensive TRAIL expression in their livers (Figure 4d). Discussion In this study, MK0683 concentration we experimentally confirmed expression profiles of 20 miRNAs in bladder cancer and corresponding noncancerous bladder tissues. qPCR assay showed that all of them had lower abundance in bladder cancer in comparison with normal bladder tissue. Our results were in accordance with previous reports from other research groups. The differential MycoClean Mycoplasma Removal Kit expression level of these miRNAs made it feasible that their MREs can be utilized to control TRAIL expression specifically in bladder cancer cells. Luciferase reporter assays showed that miR-1, miR-99a, miR-101, miR-133a, miR-218, miR-490-5p, miR-493 and miR-517a only had limited suppressive effect on luciferase expression in bladder cancer cells when their MREs were applied. Further

investigation indicated that MREs of miR-1, miR-133a and miR-218 inhibited luciferase expression in normal bladder cells. Therefore, MREs of miR-1, miR-133a and miR-218 were believed to prevent exogenous gene expression from normal bladder mucosal cells without affecting its expression in bladder cancer cells. UPII promoter has been utilized for specific TRAIL expression in bladder cancer cells. However, gene expression controlled by this promoter is not strictly bladder cancer-specific, due to the remaining activity of UPII promoter in normal bladder mucosal cells [49]. Therefore, other strategies should be developed for preventing TRAIL expression from normal bladder cells. We employed multidisciplinary approaches to prove that TRAIL expression was greatly inhibited in Ad-TRAIL-MRE-1-133-218-infected normal bladder epithelial cells. These data demonstrated this recombinant adenovirus as a vehicle for TRAIL expression with a high bladder cancer-specificity.

Based on this trial, the U.S. FDA approved pemetrexed for second-line treatment of locally advanced or metastatic NSCLC [6]. In our study, 53 patients were enrolled. All patients had experienced platinum-based chemotherapy. Most of patients BTK inhibitor (>70%) had good clinical conditions (ECOG PS 0 or 1). The patients treated with pemetrexed plus platinum were supplemented with dexamethasone, folic acid and vitamin B12. The addition of folic acid and

vitamin B12 supplementation markedly reduced the toxicity profile of pemetrexed, as shown in a previous trial comparing pemetrexed administered with or without vitamins [30]. The median number of cycles received was 3. No patient achieved CR. Seven of the 53 patients (13.2%) showed PR. The ORR (13.2%) is higher than that of single pemetrexed (8.8%) reported by Hanna et al. The stable disease rate was 67.9% in this study, which was markedly higher than that of single pemetrexed (45.8%) in Hanna’s study. The DCR for pemetrexed plus cisplatin/carboplatin Epigenetics Compound Library research buy in this study and single pemetrexed in Hanna’s study were 81.1% and 54.6%, respectively, which also have a significant difference. The median progression-free survival was 6.0 months, which was two times longer than that of single pemetrexed (2.9 months) in Hanna’s study. The median OS time

was 10.0 months, which was also longer than that of single pemetrexed (8.3 months). The 1-year survival rate was 40.9%, which was higher than that of single pemetrexed (29.7%) in Hanna’s study. Compared with pemetrexed pheromone single agent chemotherapy, our study showed that locally advanced or metastatic NSCLC patients having experienced platinum-based chemotherapy might acquire a higher objective response rate, higher disease control rate, longer PFS, longer OS and higher 1-year survival rate from pemetrexed combined with platinum chemotherapy. The main reason we achieved better results should be due to the addition of platinum chemotherapy drugs. Of course, to exclude the impact of

race factor, we need further randomized controlled study. In our study, the most frequent hematological toxicities were neutropenia and thrombocytopenia (any grade) and the most frequent nonhematological toxicities were nausea/vomiting, fatigue, pyrexia and rash (any grade). The incidence of grade 3/4 neutropenia and thrombocytopenia was 9.5% and 7.6%, which was higher than that of pemetrexed single agent chemotherapy in Hanna’s randomized phase III study (5.3% and 1.9%). The incidence of grade 3/4 Anemia was 0, which was 4.2% in that randomized phase III study. The nonhematological toxicities were similar to single pemetrexed observed in Hanna’s study. Although the incidence of neutropenia and thrombocytopenia in pemetrexed plus cisplatin/carboplatin chemotherapy for previously treated locally advanced or metastatic NSCLC patients was slightly higher than pemetrexed single chemotherapy, the adverse events were tolerable. After treated, all patients acquired recovery from hematological toxicities.

Figure 9 SgPg vs Sg Sugar transport. Labels, abbreviations and color coding as described for Figure 8, for the S. gordonii with P. gingivalis comparison to S. gordonii. Figure 10 SgPgFn vs Sg Energy metabolism and end products. Labels, abbreviations

and color coding as described for Figure 8, for the S. gordonii with P. gingivalis and F. nucleatum comparison to S. gordonii. Figure 11 SgPg vs SgFn Energy metabolism and end products. Labels, abbreviations and color coding as described for Figure 8, for the S. gordonii with P. gingivalis comparison to S. gordonii with F. nucleatum. Figure 12 SgPgFn vs SgFn Energy metabolism and end products. Labels, abbreviations and color coding as described for Figure 8, for the S. gordonii with P. Adriamycin cell line gingivalis and F. nucleatum comparison to S. gordonii with F. nucleatum. Figure 13 SgPgFn vs SgPg Energy metabolism and end this website products. Labels, abbreviations and color coding as described for Figure 8, for the S. gordonii

with P. gingivalis and F. nucleatum comparison to S. gordonii with P. gingivalis. In contrast to the PTS system proteins, many of the proteins feeding sugars into the glycolysis and pentose phosphate pathways show increased levels in mixed communities (Figures 8, 9, 10). This is consistent with the higher protein levels in the energy pathways as well as high levels of available sugar. The implication is that the second, low pH induced, pathway has high activity under the mixed community conditions. Induction of the second sugar Ribonuclease T1 transport system would again be consistent with a low pH environment. While Sg does not commonly reduce pH to levels where demineralization occurs, it can produce acid at pH’s as low as 5.5 and so could be responsible for a lower pH in the mixed communities [9]. It is important to note that these experiments were conducted in media without exogenous nutrients and thus Sg may be undergoing

a programmed response to the presence of the other species, rather than a response to altered nutrient levels. Alcohols and acidic end products In mixed species communities Sg showed an extensive shift in pathways for byproduct production. The end products of energy metabolism are often important components of pathogenicity and community development. Changes in pH can select for different organisms [3]. End products can also provide nutrients for other community members. S. gordonii has been shown to increase A. actinomycetemcomitans pathogenicity through metabolic cross-feeding of L-lactate [7]. Figures 2, 3, 4, 5, 6, 7 show the end products of Sg energy metabolism, formate, acetate, L-lactate, and ethanol.

(ZIP 3 MB) Additional file 7: Table S7. Statistically significantly

differentially expressed probe sets in the gingival tissues according to levels of P. micra in the adjacent pockets. (ZIP 3 MB) Additional file 8: Table S8. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of C. rectus in the adjacent pockets. (ZIP 3 MB) Additional file 9: Table S9. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of E. corrodens in the adjacent pockets. buy Panobinostat (ZIP 3 MB) Additional file 10: Table S10. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of V. parvula in the adjacent pockets. (ZIP 3 MB) Additional file 11: Table S11. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of A. naeslundii in the adjacent pockets. (ZIP 3 MB) Additional file 12: Table S12. A list of the top 100 differentially expressed probe sets in the gingival tissues according to levels of ‘Etiologic burden’ in the adjacent pockets. (XLS 32 KB) Additional file 13: Table S13.

A list of the top 100 differentially expressed probe sets in the gingival see more tissues according to levels of ‘Putative burden’ in the adjacent pockets. (XLS 26 KB) Additional file 14: Table S14. A list of the top 100 differentially expressed probesets in the gingival tissues according to levels of ‘Health-associated burden’ in the adjacent pockets. (XLSX 17 KB) Additional file 15: Table S15. List of all statistically significantly regulated GO groups in the gingival tissues according to levels of each of the 11 investigated species in the adjacent pockets. (ZIP 646 KB) References 1. Socransky SS, Haffajee AD: Periodontal microbial ecology. Periodontol 2000 2005, 38:135–187.CrossRefPubMed 2. Marsh PD: Dental plaque: biological significance of a biofilm and community lifestyle. J Clin Periodontol 2005,32(Suppl 6):7–15.CrossRefPubMed 3. Listgarten MA, Helldén Thalidomide L: Relative distribution of bacteria at clinically healthy and periodontally diseased sites in humans. J Clin Periodontol

1978,5(2):115–132.CrossRefPubMed 4. Socransky SS, Haffajee AD, Smith C, Dibart S: Relation of counts of microbial species to clinical status at the sampled site. J Clin Periodontol 1991,18(10):766–775.CrossRefPubMed 5. Page RC, Schroeder HE: Pathogenesis of inflammatory periodontal disease. A summary of current work. Laboratory investigation; a journal of technical methods and pathology 1976,34(3):235–249.PubMed 6. Offenbacher S: Periodontal diseases: pathogenesis. Ann Periodontol 1996,1(1):821–878.CrossRefPubMed 7. Chung CH, Bernard PS, Perou CM: Molecular portraits and the family tree of cancer. Nat Genet 2002,32(Suppl):533–540.CrossRefPubMed 8. Quackenbush J: Microarray analysis and tumor classification. N Engl J Med 2006,354(23):2463–2472.CrossRefPubMed 9.

:

a transmission and scanning electron microscopy study. J Parasitol 1996, 82:769–77.PubMedCrossRef 29. Smith DS, Treherne JE: Functional aspects of the organization of the insect nervous system. Adv Insect Physiol 1963, 1:401–84.CrossRef selleck screening library 30. Treherne JE, Schofield PK: Mechanisms of ionic homeostasis in the central nervous system of an insect. J Exp Biol 1981, 95:61–73.PubMed 31. Carlson SD, Juang JL, Hilgers SL, Garment MB: Blood Barriers of the Insect. Annu Rev Entomol 2000, 45:151–74.PubMedCrossRef 32. Alsam S, Sissons J, Jayasekera S, Khan NA: Extracellular proteases of Acanthamoeba castellanii (encephalitis isolate belonging to T1 genotype) contribute to increased permeability in an in vitro model of the human blood-brain barrier. J Infect 2005, 51:150–6.PubMedCrossRef Authors’ contributions NK conceived the study. PM and RK designed and performed the histological studies. PM, NK, and GG designed and performed all other assays. GG, PM, and NK did all statistical analyses on acquired data. NK and PM wrote the original manuscript. GG and RK helped

to craft the final manuscript. All authors approved the final manuscript.”
“Background Biofilms plague both medical and industrial surfaces and are difficult to treat with common antimicrobial strategies [1, 2]. Cells residing within biofilms are often tolerant Methocarbamol to antimicrobial agents at concentrations thousands of times higher than what is necessary to eradicate the same cells growing planktonicly (e.g. [3, 4]). This recalcitrance this website is likely due to a combination of physical and physiological factors. Cells from a disrupted biofilm typically become susceptible to antibiotics when regrown planktonicly

[5–7]. The ubiquity of biofilms and their associated financial costs have inspired intensive antifouling efforts. A widely used anti-biofilm approach is to impregnate surfaces with antiseptics or antibiotics (reviewed in [8, 9]). The benefit of antimicrobial impregnated medical devices is still controversial despite decades of research and investment. For example, after reviewing years of studies, McConnell et al. [10, 11] conclude that more rigorous investigations are required to either support or refute the hypothesis that central venous catheters coated with antimicrobial agents reduce the rate of blood stream infections. While other researchers disagree with these conclusions (e.g. [12]), the fact there is still a debate regarding the efficacy of these strategies suggests there is need for better technologies and a better understanding of what parameters influence bacterial tolerance to antimicrobial agents. The current study aims to characterize colony biofilm antibiotic tolerance as a function of culturing conditions.

Journal of Nutrition 2007, PD-0332991 ic50 137:357–362.PubMed 10. Phillips SM, Hartman JW, Wilkinson SB: Dietary protein to support anabolism with resistance exercise in young men. J Am Coll Nutr 2005,

24:134S-139S.PubMed 11. Brown EC, DiSilvestro RA, Babaknia A, Devor ST: Soy versus whey protein bars: effects on exercise training impact on lean body mass and antioxidant status. Nutr J 2004, 3:22.CrossRefPubMed 12. Candow DG, Burke NC, Smith-Palmer T, Burke DG, Candow DG, Burke NC, Burke DG: Effect of whey and soy protein supplementation combined with resistance training in young adults. Int J Sport Nutr Exerc Metab 2006,16(3):233–244.PubMed 13. Haub MD, Wells AM, Tarnopolsky MA, Campbell WW: Effect of protein source on resistive-training-induced changes in body composition and muscle size in older men. Am J Clin Nutr 2002, 76:511–517.PubMed 14. Tham DM, Gardner CD, Haskell WL: Clinical review 97: Potential health benefits of dietary phytoestrogens: a review of the clinical, epidemiological, and mechanistic evidence. Journal of Clinical Endocrinology & Metabolism 1998, 83:2223–2235.CrossRef

15. Clarkson TB: Soy, soy phytoestrogens and cardiovascular disease. J Nutr 2002, 132:566S-569S.PubMed 16. Vitolins MZ, Anthony M, Burke GL: Soy protein isoflavones, lipids and arterial disease. Curr Opin Lipidol 2001, 12:433–437.CrossRefPubMed 17. McCarty MF: Vegan proteins may reduce risk of cancer, obesity, and cardiovascular disease by promoting increased glucagon GS-1101 supplier activity. Med Hypotheses 1999, 53:459–485.CrossRefPubMed 18. Anderson JW, GBA3 Johnstone BM, Cook-Newell ME: Meta-analysis of the effects of soy protein intake on serum lipids. N Engl J Med 1995, 333:276–282.CrossRefPubMed 19. Zhang B, Chen YM, Huang LL, Zhou XX, Chen CG, Ye YB, Su YX: Greater habitual soyfood consumption is associated with decreased carotid intima-media thickness and better plasma lipids in Chinese middle-aged adults. Atherosclerosis 2008, 198:403–411.CrossRefPubMed 20.

Kalman D, Feldman S, Martinez M, Krieger DR, Tallon MJ: Effect of protein source and resistance training on body composition and sex hormones. J Int Soc Sports Nutr 2007, 4:4.CrossRefPubMed 21. Wilkinson SB, Tarnopolsky MA, Macdonald MJ, Macdonald JR, Armstrong D, Phillips SM: Consumption of fluid skim milk promotes greater muscle protein accretion after resistance exercise than does consumption of an isonitrogenous and isoenergetic soy-protein beverage. Am J Clin Nutr 2007, 85:1031–1040.PubMed 22. American College of Sports Medicine, Roitman JL, Herridge M: ACSM’s resource manual for guidelines for exercise testing and prescription 4 Edition Philadelphia: Lippincott Williams & Wilkins 2001. 23.