In fact, n-doped Si was found to be etched faster than p-doped Si [17, 23], and the etching rate decreases with increasing dopant concentration for both n- and p-doped Si [11, 17, 24]. Meanwhile, Li et al. reported that the etching rate showed only small variation for a Au-coated p+, p−, and n+ Si substrate and a Pt-coated Si was etched faster compared with a Au-coated Si [25]. Obviously, abovementioned experiment results cannot be accounted for only

by the charge transfer through an ideal Schottky barrier. A rigorous model should consider the full process of charge transfer including the generation of holes, diffusion in the metal, going through the Schottky barrier, as well as diffusion in the Si substrate, which involved the catalytic activity of the noble metal for oxidant (affecting the generation rate of holes), the surface state of Si, the diffusion of holes from the etching selleck screening library front to off-metal areas or to the sidewall of the formed structure (especially in a heavily doped Si, resulting in the formation of a porous structure), etc. [14, 17]. However, this has not been done so far, and it needs to be further Selleckchem GSK2245840 explored. Metal-assisted

chemical etching of Si allows fabricating large-area SiNWs with predetermined doping type and doping level. By utilizing the AAO template, the diameter, spacing, and areal density of nanowires can be further controlled through optimizing the anodizing conditions. Moreover, the SiNWs fabricated by this method are well-discrete and vertically aligned, which is critical for subsequent coating of other layers in device fabrication. Therefore, this technique is very promising for device fabrication based on SiNW array, for instance, SiNW radial p-n junction solar cells [6]. Conclusions In conclusion, combining the AAO template and the metal-assisted chemical etching process results in large-area, vertically aligned SiNWs with a uniform diameter along the height direction. The thickness of the Au film

was found to affect the etching rate of Si, which might from be caused primarily by the charge transfer process. A thick Au mesh that comes in contact with Si reduces the Au/Si Schottky barrier height, which facilitates the see more injection of electronic holes from the Au mesh into the Si, thereby resulting in a high etching rate of Si. This method provides a simple and low-cost approach to the control of the doping type, doping level, diameter, spacing, areal density of SiNW arrays, etc. Well-discrete and vertically aligned SiNW array fabricated by this method is very promising for device applications based on SiNW arrays. Acknowledgements This work is partly supported by the National Natural Science Foundation of China under grant nos. 61106011 and 51172109 and the Anhui Province Natural Science Foundation under grant no. 1308085QF109. References 1. Goldberger J, Hochbaum AI, Fan R, Yang PD: Silicon vertically integrated nanowire field transistors. Nano Lett 2006, 6:973–977.

[14]. Tumors were considered as being positive for ER if Histo-score was above 100. The results of basal keratin membranous staining were classified as follows: negative – no staining seen in invasive cancer cells, positive — weak or strong staining seen in invasive cancer cells. HER2 expression was examined with the commercially available Herceptest kit from Dako and score +3 denoted HER2-positive tumors. Real-time RT-PCR analysis Tumor samples were stored at -80°C until mRNA extraction using TRIzol® Reagent (Invitrogen Corporation, USA). Synthesis of

cDNA was performed from 10 μg of total mRNA at a total volume of 70 μl using ImProm-II™ (Promega Corporation, USA) reverse transcriptase. Next, cDNA samples were diluted with sterile deionized water to a total volume of 140 μl. Volumes of 2 μl (corresponding to 0, 14 μg of total mRNA) were used for PCR. Real-time RT-PCR was performed using Rotor-Gene™

this website 3000 (Corbett Research). buy FG-4592 Sequences of primers used, annealing and detection temperatures are presented in Table 2. All primers were designed to not amplify genomic DNA (usually one is positioned on exon-exon junction). Primer pairs were blasted against human genome ref_assembly 37.1 using electronic PCR on NCBI Genome Database and showed no genomic or pseudogenes PCR products. Table 2 Real-time RT-PCR primers and reaction conditions Gene primers (5′-3′) Forward Reverse Annealing temperature ( ° C) Detection temperature ( ° C) PCR product size (base pairs) Beta-2-microglobulin ( B2M ) TGAGTGCTGTCTCCATGTTTGA TCTGCTCCCCACCTCTAAGTTG 50 81 88 H3 histone, family 3A ( H3F3A ) AGGACTTTAAAAGATCTGCGCTTCCAGAG ACCAGATAGGCCTCACTTGCCTCCTGC 65 72 76 Ribosomal phosphoprotein ( RPLP0 ) ACGGATTACACCTTCCCACTTGCTAAAAGGTC AGCCACAAAGGCAGATGGATCAGCCAAG 65 72 69 Ribosomal protein S17 ( RPS17 ) ACCCCAATGTCAAGGAGATCAAGGTCCTG

TCGGCAGCCAGCTCGTGAGTAATG 64 72 87 Estrogen receptor 1 ( ER ) ATCTCGGTTCCGCATGATGAATCTGC TGCTGGACAGAAATGTGTACACTCCAGA 65 72 98 Keratin 5 (CK5) ATCGCCACTTACCGCAAGCTGCTGGAGGG AAACACTGCTTGTGACAACAGAG 65 72 102 Keratin 17 ( CK17 ZD1839 manufacturer ) ATGTGAAGACGCGGCTGGAGCAGGA ACCTGACGGGTGGTCACCGGTTC 65 72 109 Keratin 14 ( CK14 ) TTTGGCGGCTGGAGGAGGTCACA ATCGCCACCTACCGCCGCCTG 65 72 109 All reactions were made in triplicate. Detection of PCR products was performed with SYBR™ green I using qPCR Core kit for SYBR™ green I (Eurogentec, Belgium). Expression levels of target genes were normalized using four housekeeping genes: B2 M, H3F3A, RPLP0, and RPS17. Relative gene expression was calculated with the use of the mathematical model described by Small molecule library supplier Pfaffl. Statistical analysis Mann-Whitney U test was employed to evaluate significance of differences in mRNA level between groups. Dichotomized values of mRNA level were compared with immunohistochemistry using the matched pairs Liddell’s exact test and Scott’s π test.

J Phys: Condens Matter 2011, 23:434001.CrossRef 40. Chelikowsky JR, Troullier N, Saad Y: Finite-difference-pseudopotential method: electronic structure calculations without a basis. Phys Rev Lett 1994, 72:1240.CrossRef 41. Hirose K, Ono T, Fujimoto Y, Tsukamoto S: First-Principles Calculations in Real-Space Formalism. London: Imperial College Press; 2005. 42. Knowles PJ, Cooper B: A linked electron pair functional. J Chem Phys 2010,

133:224106.CrossRef 43. Trail JR, Needs RJ: Smooth relativistic Hartree–Fock pseudopotentials for H to Ba and Lu to Hg. J Chem Phys 2005, 122:174109.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions click here HG conceived, planned this study, carried out the coding of the computation program, and drafted the manuscript. MK and KH participated in the discussions on the basic theory of the present method. AS performed tunings of the code and made all of calculations. All authors read and approved the final manuscript.”
“Background One of the key factors in the field of spintronics is the spin filter effect, which plays a fundamental role as the spin-polarized current source in devices such as spin-field-effect transistors and single solid-state qubits. The carbon-related nanostructures have recently been fabricated

experimentally and explored theoretically this website to clarify magnetic ordering mainly in the zigzag edge of graphene [1–3]. These nanostructures are very attractive to the spin filter materials due to the remarkable long-spin

coherence 7-Cl-O-Nec1 cost distance and high carrier mobility. On the other hand, some groups proposed the spin filter effect using quantum dots [4, 5]. When the quantum dots are formed, the movements of electrons are allowed in two-dimensional gas. The movements are then restricted to zero dimension Unoprostone by an external field and the insulator around the quantum dots. If the small carbon flakes with a zigzag edge surrounded by an insulator have ferromagnetic ground-state electronic structures, this situation of carbon atoms resembles closely that of the quantum dots mentioned above. Okada et al. [6] studied the electronic structure of the two-dimensional triangular graphene flake surrounded by a hexagonal boron nitride sheet, which is called the BNC structure, and clarified that the zigzag edges of the graphene flake caused the magnetic ordering. Thus, the BNC structure has a large potential for the spin filter effect materials. However, in order to employ the BNC structure for the spin filter application, it is important that these BNC structures exhibit large magnetic moments and high spin-polarized transport properties when the BNC structures are connected to electrodes. In the previous study [7], we investigated the electronic structure and transport property of the BNC structures proposed by Okada et al.