40) objective. The criterion for having internalization was the presence in the neuronal soma of ten or more NK1R Everolimus order endosomes, defined as a small region of bright staining separated from the cell surface. The person counting the neurons was blinded to the treatment. All NK1R neurons in lamina I were counted in each histological section. In experiments in slices, at least three sections per slice were counted. In experiments in

vivo, four sections were counted per spinal segment. Confocal images were acquired using a Leica TCS-SP confocal microscope, using objectives of 20× (numerical aperture 0.70) and 100× (numerical aperture 1.40). One set of images (Fig. 1D) was acquired with a Zeiss LSM-710 confocal microscope using similar objectives. Excitation light for the Alexa Fluor 488 fluorophore

BIBF 1120 datasheet was provided by the 488-nm line of an argon laser. The emission window was 500–570 nm (emission peak for Alexa Fluor 488 is 519 nm). The pinhole was 1.0 Airy unit, corresponding to the objective used. Images were acquired in grayscale as confocal stacks of sections of 1024 × 1024 pixels. Photomultiplier gain and offset were individually adjusted for each image to avoid pixel saturation and loss of background detail. Each section was averaged 2–4 times to reduce noise. Images of the medial and central parts of the dorsal horn obtained with the 20× objective were used to show the location of the neurons imaged with the 100× objective (Fig. 1). Confocal stacks acquired with the 20× objective were processed using adaptive point spread function (‘blind’) deconvolution to reduce blur (Wallace et al., 2001; Cannell et al., 2006; Holmes et al., 2006), using the program autoquant X 2.0.1 (Media Cybernetics, Inc., Bethesda, MD, USA). Images taken with the 100× objective were not deconvolved because their native low blur made this unnecessary. The program imaris 6.1.5 (Bitplane AG, Zurich, Switzerland) was used to crop the confocal stacks in three dimensions. Images at 20× were cropped only in the z-dimension to choose the five brightest

optical Linifanib (ABT-869) sections. Images at 100× were cropped in x-y to show the soma and proximal dendrites of the target neurons, and in the z-dimension into three optical sections through the middle of the soma. Occasionally, several neurons were cropped from the same confocal stack. Image resolution was preserved in the cropping, so that pixels in Fig. 1 correspond to the pixels acquired by the confocal microscope. Voxel dimensions were 488 × 488 × 1180 nm with the 20× objective and 98 × 98 × 285 nm with the 100× objective. After cropping, a two-dimension projection picture was generated in Imaris and imported into adobe photoshop 5.5 (Adobe Systems Inc., Mountain View, CA, USA), which was used to make slight adjustments in the gamma of the images so that important details are clearly visible in Fig. 1. adobe photoshop was also used to compose the multi-panel figures and to add text and arrows.

We are confident that this collection of papers will be of significant interest to researchers in the field and advance our understanding of this truly versatile bacterial genus. “
“Plasmids are and will remain important cloning vehicles for biotechnology.

They have also been associated with the spread of a number of diseases and therefore are a subject of environmental concern. With the advent of sequencing technologies, the database of plasmids is increasing. It will be of immense importance Tanespimycin molecular weight to identify the various bacterial hosts in which the plasmid can replicate. The present review article describes the features that confer broad host range to the plasmids, the molecular basis of plasmid host range evolution, and applications in recombinant DNA technology and environment. “
“San Giuseppe Hospital-AUSL 11, Empoli, Italy Bacillus thuringiensis is widely used as a biopesticide in forestry and agriculture, being able to produce potent species-specific insecticidal toxins and considered nonpathogenic to other animals. More recently, however, repeated

observations are documenting the association of this microorganism with various infectious diseases in humans, such as food-poisoning-associated diarrheas, periodontitis, bacteremia, as well as ocular, burn, and wound ZD1839 infections. Similar to B. cereus, B. thuringiensis produces an array of virulence factors acting against mammalian cells, such as phosphatidylcholine- and phosphatidylinositol-specific phospholipase C (PC-PLC and PI-PLC), hemolysins, in particular hemolysin BL (HBL), and various enterotoxins. The contribution of some of these toxins to B. thuringiensis pathogenicity has been studied in animal models of infection, following intravitreous, intranasal, or intratracheal inoculation. These studies lead to the speculation that the activities Thalidomide of PC-PLC, PI-PLC, and HBL are responsible for most of the pathogenic properties of B. thuringiensis

in nongastrointestinal infections in mammals. This review summarizes data regarding the biological activity, the genetic basis, and the structural features of these membrane-damaging toxins. “
“DOI: 10.1111/j.1574-6968.2010.02089.x In the paper by Park et al. (2010), the author’s name Hee Joong Lee appeared incorrectly as Hee Jung Lee. It is printed correctly above. “
“The treatment of opportunistic fungal infections is often difficult as the number of available antifungal agents is limited. Nowadays, there is increasing interest in the investigation of the antifungal activity of nonantifungal drugs, and in the development of efficient antifungal combination therapy.

We are confident that this collection of papers will be of significant interest to researchers in the field and advance our understanding of this truly versatile bacterial genus. “
“Plasmids are and will remain important cloning vehicles for biotechnology.

They have also been associated with the spread of a number of diseases and therefore are a subject of environmental concern. With the advent of sequencing technologies, the database of plasmids is increasing. It will be of immense importance buy MK0683 to identify the various bacterial hosts in which the plasmid can replicate. The present review article describes the features that confer broad host range to the plasmids, the molecular basis of plasmid host range evolution, and applications in recombinant DNA technology and environment. “
“San Giuseppe Hospital-AUSL 11, Empoli, Italy Bacillus thuringiensis is widely used as a biopesticide in forestry and agriculture, being able to produce potent species-specific insecticidal toxins and considered nonpathogenic to other animals. More recently, however, repeated

observations are documenting the association of this microorganism with various infectious diseases in humans, such as food-poisoning-associated diarrheas, periodontitis, bacteremia, as well as ocular, burn, and wound NVP-BEZ235 research buy infections. Similar to B. cereus, B. thuringiensis produces an array of virulence factors acting against mammalian cells, such as phosphatidylcholine- and phosphatidylinositol-specific phospholipase C (PC-PLC and PI-PLC), hemolysins, in particular hemolysin BL (HBL), and various enterotoxins. The contribution of some of these toxins to B. thuringiensis pathogenicity has been studied in animal models of infection, following intravitreous, intranasal, or intratracheal inoculation. These studies lead to the speculation that the activities Neratinib of PC-PLC, PI-PLC, and HBL are responsible for most of the pathogenic properties of B. thuringiensis

in nongastrointestinal infections in mammals. This review summarizes data regarding the biological activity, the genetic basis, and the structural features of these membrane-damaging toxins. “
“DOI: 10.1111/j.1574-6968.2010.02089.x In the paper by Park et al. (2010), the author’s name Hee Joong Lee appeared incorrectly as Hee Jung Lee. It is printed correctly above. “
“The treatment of opportunistic fungal infections is often difficult as the number of available antifungal agents is limited. Nowadays, there is increasing interest in the investigation of the antifungal activity of nonantifungal drugs, and in the development of efficient antifungal combination therapy.

The drift of these parameters might bring out the variation of luciferase activity and, consequently, affect the application of bioreporters in detection of samples from natural aquatic environments.

To determine the application range of bioreporter PD0325901 mouse Palr0397-luxAB, we studied the influence of initial inoculum density and concentrations of nitrogen, phosphorus, Co2+, Mn2+, Zn2+, and Cu2+ on luciferase activity of the bioreporter under laboratory conditions in Fraquil medium with 10, 100, and 1000 nM Fe3+. The bioreporter cells were incubated for 12 h under the growth conditions described previously prior to bioluminescence measurement. Previous research revealed that high biomass of bioreporters (e.g. 107 cells mL−1)

could be used to increase bioreporter signal intensity (Van Der Meer et al., 2004). However, owing to the high levels of various organic chelants (Powell & Wilson-Finelli, 2003a ,b) and slow kinetics of reaction (Hudson & Morel, 1990), the concentration of dissolved iron is very low in some freshwaters (Nriagu et al., 1996; Sterner et al., 2004; Porta et al., 2005). The use of high biomass was likely to result in a bulk depletion of bioavailable iron and affect the practical assessment of iron bioavailability. With the increase in cell inoculum density (from 0.02 OD730 nm to 0.11 OD730 nm), luciferase activity of bioreporter Palr0397-luxAB increased firstly and then decreased (Fig. 2). A large consumption of bioavailable

IWR-1 cell line Celecoxib iron would promote the biosynthesis of siderophores to complex Fe3+ into cells (Ferguson & Deisenhofer, 2002; Wandersman & Delepelaire, 2004), which led to the increase in luciferase activity as cell numbers increased. Under higher Fe3+ concentrations (e.g. 100 or 1000 nM), the increase in siderophores because of the increased cell number could accelerate Fe3+ transport so as to rapidly enhance iron bioavailability, which might inversely suppress the use of iron to reduce luciferase activities of the bioreporter. At lower Fe3+ concentrations (e.g. 10 nM), when the cell numbers reached a high level, huge depletion of iron by excessive algal cells might affect the normal function of cells, thus inhibiting luciferase activity. Therefore, an initial inoculum density of OD730 nm = 0.06 was appropriate for the detection of bioavailable iron in water samples by bioreporter Palr0397-luxAB. The concentrations of nitrogen (N) and phosphorus (P) are greatly different in freshwaters. For example, the concentrations of total nitrogen (TN) and total phosphorus (TP) are 13.6–42.4 and 0.16–0.28 μM in Lake Erie (Charlton & Milne, 2004; DeBruyn et al., 2004). By contrast, the concentrations of TN and TP in Taihu, Chaohu, and Dianchi lakes of China, respectively, are 116.4–460.7 and 0.74–12.52 μM, 67.9–274.3 and 2.58–13.55 μM, and 214.3–1071.4 and 4.19–45.16 μM (Wang & Chen, 2009; Xu et al., 2010; Li & Xiao, 2011; Wilhelm et al., 2011).

, 2000). The purified degenerate probe (TIB Molbiol, Berlin, Germany) was digoxygenin labelled at both the 5′ and the 3′ ends. Colony hybridization was conducted as described in the digoxygenin application manual for filter hybridization (Roche, Mannheim, Germany). Hybridization was conducted with 10 mL DIG Easy Hyb solution containing 25 ng mL−1 digoxygenin-labelled probe for 4 h at 30 °C. Antidigoxygenin conjugated with alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche) and digoxygenin detection buffer (Roche) was used for probe–target hybrid detection. The detection buffer contained 0.175 mg mL−1 5-bromo-4-chloro-3-indolyl phosphate, toluidine salt and 0.349 mg mL−1

find more nitro blue tetrazolium chloride. The rest of the procedure was conducted according to the selleck screening library digoxygenin application manual. Positive clones were subjected to plasmid extraction and purification. Sequencing was performed at Inqaba Biotechnical Industries (South Africa) using a Spectrumedix SCE2410 genetic analysis system (SpectruMedix, State College, PA). Homology searches were performed against the nonredundant nucleotide GenBank database using the basic local alignment search tool (blast (Altschul et al., 1990). An ORF encoding a putative thioredoxin reductase (other than the soluble ferric reductase) was found in

the draft genome sequence of T. scotoductus SA-01, which became available later (conducted by our group, unpublished data). The soluble ferric reductase (FeS, accession number FN397678) was amplified using a forward primer (CAT ATGGAGCACACCGACGTGATCATC) with an NdeI recognition site (underlined) and a reverse primer (GAATTC AGGCCGGTGCTTTCTCCTC) with an EcoRI recognition site (underlined). The thioredoxin PI-1840 reductase (TrxB, accession number FN397677) was also amplified by PCR using a forward primer (CATATGGAGTTCACCCTCACGGGGC TTG) and a reverse primer

(GAATTCTAGGGTTTTACC TTCTCGTGGGCCTC) with NdeI and EcoRI recognition sites, respectively. The PCR products of the above-mentioned ORFs were ligated into pGEM®-T easy (Promega, Madison, MI) according to the manufacturer’s instructions and transformed into One Shot TOP10 (Invitrogen, Carlsbad, CA) chemically competent E. coli cells for proliferation. The plasmids were isolated using the Biospin Gel extraction kit (Bioflux, China), double digested with EcoRI (0.5 U μL−1, Fermentas) and NdeI (0.5 U μL−1, Fermentas) for 4 h at 37 °C and subcloned into the pET28b(+) vector. These recombinant clones were verified by sequencing and transformed into BL21(DE3) (Lucigen) chemically competent cells according to the manufacturer’s instructions. The transformants were inoculated into kanamycin-containing (50 mg mL−1) Luria– Bertani media and cultured until an OD600 nm of 0.8 was reached before isopropyl-β-d-thiogalactopyranoside was added to a final concentration of 1 mM to induce expression.

Pharmacy practice research can benefit from research that uses both ‘numbers’ (quantitative) and ‘words’ (qualitative) to develop a strong evidence base to support pharmacy-led services. In the first article of the pair we introduced the basic concepts of mixed-methods Olaparib chemical structure research including its definition, advantages and typologies. In this second article the rationale, applications, limitations and challenges of conducting a mixed-methods study are discussed. A framework to improve quality of reporting mixed-methods studies is also proposed for researchers and

reviewers. Not all research problems require mixed-methods enquiry and therefore the rationale for choosing a mixed-methods approach should always be presented. A literature review by Selleckchem Lumacaftor Greene et al. in 1989 identified five reasons for conducting mixed-methods research including triangulation, complementarity, development, initiation and expansion

(explained below).[1] In 2006, in a review of social science literature, Bryman expanded the list and identified 16 reasons for conducting mixed-methods research.[2] To date the use of mixed-methods research in pharmacy practice is relatively limited. To illustrate this point, a quick Medline and EMBASE search combining the keywords ‘mixed-methods’ or ‘multi-methods’ with ‘pharmacy’ or ‘Pharmacist’ resulted only in 33 hits (after deduplication; date of search 2 April 2012). However, it should be noted here that it was not a comprehensive search to locate all mixed-methods studies but rather it aimed to identify examples and highlight the limited use of mixed-methods research in the field of pharmacy practice. In this section we will explore some examples of how pharmacy practice researchers have used mixed methods together with a discussion of the strengths and weaknesses of the reporting within each study. We have purposively selected these examples to illustrate the five reasons

identified by Greene et al.[1] for using a mixed-methods approach. Triangulation Adenosine triphosphate seeks convergence, corroboration and correspondence of results from different methods’.[1] Guirguis used a mixed-methods approach (concurrent triangulation) to study pharmacists’ experiences and beliefs about an interactive communication approach, the three prime questions (3PQs) model.[3] Developed in the USA, 3PQs is a patient-centred model designed to assess the patient’s knowledge and recognize information deficits before providing education. The quantitative methods included pharmacist self-report forms to record their experiences using the 3PQs and a 19-item questionnaire survey (16 closed and three open-ended questions) for evaluating pharmacist self-efficacy and role beliefs towards 3PQs. The qualitative method included a focus-group interview to elaborate on the pharmacists’ experience using 3PQs.

These drawings also provide a reflection of the learning process students experience during the MPharm, with clear identifiers of aspects of the curriculum and the objectives of integrating scientific knowledge with clinical practice. 1. Florence, A. The physical sciences in a clinical curriculum – a personal perspective. Pharm J. 2011; 287: 657. 2. Chambers, D.W. Stereotypic Images of the Scientist: The Draw – A – Scientist Test. Science Education 1983; 67: 255–265. Nicola Gray1, Julie Prescott2 1Green Line Consulting Limited, Manchester, UK, 2University of Central Lancashire, Preston, UK To explore community pharmacists’ engagement and confidence in responding

to young people’s health concerns There was significant engagement with young people in terms of dispensing prescriptions and providing enhanced services, but very little MUR activity There are missed opportunities to engage young people and their families in adherence support and medicines optimisation Everolimus activities in pharmacies There has been a traditional emphasis on the care of older people by pharmacists, linked to widespread use of medicines by this group. Adherence, however, is worse among teenagers than any other age group1. The recent establishment of a Children and Young People’s

Health Outcomes Forum has highlighted the need for patient-centred care in a variety of settings, and advocates actions around medicines in the context of patient safety. Four Teenage Health Demonstration sites (THDS) were established under the Labour government to explore and share good practice in young people’s selleck chemicals health. The aim of this project was to explore community pharmacists’ engagement and confidence in responding to young people’s health concerns, where ‘young people’ were defined as those aged 13–19 years. The four THDS areas (Bolton, Portsmouth, Hackney and Northumberland) were matched with a similar area (Kirklees, Salford, Haringey and Herefordshire respectively) based on the ONS (2010) 2001 area classification of health areas- distance from centroid2. A self-completion

survey was sent to the pharmacist in charge of each premises on the publicly available pharmaceutical list for each area. The survey included out questions about perceived frequency of engagement with young people for different pharmacy services, and confidence about this engagement. It was piloted with UCLan teacher practitioners, and revised from their comments. Data were entered into SPSS and subjected to descriptive quantitative analysis. The project did not require NRES approval, but was reviewed and approved by the Research Ethics Committee of the School of Pharmacy at UCLan. 143 surveys were returned out of 431 sent (overall response rate 33%: response rate per area ranged from 18% in Hackney to 47% in Portsmouth). The sample included a diverse range of settings, including suburban high street (22.4%), local neighbourhood shops (21.7%), health centres (18.

At

least half the people living with HIV have serum markers of previous hepatitis B virus (HBV) infection [56]. Occult hepatitis B, in which there is viral replication in Autophagy inhibitor the absence of surface antigen, is well documented in HIV-positive patients [57,58]. Reactivation of HBV and a rise in HBV DNA can occur at low CD4 cell counts, and has been documented in both HIV-positive and HIV-negative patients receiving immunosuppressive chemotherapy [59–66]. In one study of HBV surface antigen, of the HIV-positive patients treated with chemotherapy for lymphoma who did not receive antiviral prophylaxis, 32% experienced HBV reactivation of whom 41% progressed to fatal fulminant hepatitis [67]. The risk of HBV reactivation appears to be particularly high in patients treated with rituximab containing chemotherapy regimens [68]. p38 MAPK inhibitor The use of prophylactic lamivudine in people at risk of HBV reactivation who were treated for lymphoma with chemotherapy reduces the incidence of HBV reactivation, severe hepatitis and the disruptions to chemotherapy compared to historical controls [69]. A meta-analysis of 14 studies involving a total of 275 at-risk patients receiving chemotherapy who were treated with prophylactic lamivudine showed that it reduced the risk of HBV reactivation

and HBV-related hepatitis by 80–100% [70]. Patients with antibodies against hepatitis B core antigen (HBcAb) should be treated with prophylactic antivirals in line with BHIVA hepatitis guidelines (level of evidence 1B) [71] and this should be continued for at least 6 months after completion of anticancer therapy [72]. People living with HIV and malignancies should receive immunizations in line with the BHIVA immunization guidelines [55] and those who have had a splenectomy should receive vaccinations and antibiotic prophylaxis in line with national asplenism

guidelines [73]. We recommend that all patients with AIDS-defining malignancies should start HAART (level of evidence 1B). We suggest that all patients with non-AIDS-defining malignancies who are due to start chemotherapy or radiotherapy should be started on HAART unless contraindicated (level of evidence 2C). We recommend that prophylaxis against Pneumocystis jirovecii pneumonia (PCP) should be started Metformin molecular weight for those who have a CD4 cell count less than 200 cells/μL (level of evidence 1A) and should be considered at higher levels in all patients starting chemotherapy or radiotherapy (GPP). We recommend prophylaxis against MAC for individuals with a CD4 cell count less than 50 cells/μL (level of evidence 1B) and in those whose treatment puts their CD4 count at risk of falling below this level. We recommend that systemic azole antifungal prophylaxis should be used in all patients receiving chemotherapy or radiotherapy for HIV-associated malignancy (level of evidence 1D).

Moreover, neither pks1 nor pks-nrps1 contains the previously reported 232-bp KS-domain fragment cloned from Vincristine supplier C. militaris 5050 (Lee et al., 2001).

These findings indicate that C. militaris and related species represent a rich reservoir of novel secondary metabolites. Further exploration of these genes and yet undescribed genes may greatly improve our understanding of the life history of these fungi and the richness of their secondary metabolites. This work was supported by the MPG-CAS Joint Doctoral Promotion Program (DPP) and the National Natural Science Foundation of China (31170017). We thank D. Spiteller for providing the DSM 1153 strain, laboratory assistance, and helpful discussions. We also thank G. Li, H. Guo and A. Jia for laboratory assistance and C. Wang for helpful discussions. Special thanks are owed to the anonymous reviewers for their valuable comments and suggestions. Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author buy Selumetinib for the article. Fig. S1. The reduced nicotinamide adenine dinucleotide phosphate (NADPH)-binding motifs in active and inactive ER domains. Fig. S2. The chemical profiles of extracts from two Cordyceps militaris strains revealed by high-pressure liquid

chromatography coupled with mass spectrometry. Table S1. Primers used in this study. Table S2. ITS sequences used for the phylogenetic analysis. Table S3. Comparison of the eight amino acid signature sequences in the binding pockets of the A domain of NRPSs, as predicted by NRPS Prediction blast Server, and their known substrates.

“
“Burkholderia pseudomallei, the causative agent of melioidosis, exploits the Bsa type III secretion system (T3SS) to deliver effector proteins into host cells. These effectors manipulate host cell functions; thus, contributing to the ability of the bacteria to evade the immune response and cause disease. Only two Bsa-secreted effectors Buspirone HCl have been conclusively identified to date. Here, we report the identification of the third B. pseudomallei type III secreted effector protein, designated BopC. BopC is encoded by the bpss1516 gene abutting bpss1517, which encodes its putative chaperone. The genes are located in the close proximity to the bsa T3SS gene cluster of B. pseudomalleiK96243 (Fig. 1). BopC was secreted into culture supernatant by the wild-type B. pseudomallei strain, but its secretion was abolished in the bsaZ T3SS mutant. Using pull down and co-purification assays, we confirmed that BopC interacts with its putative chaperone, BPSS1517, in vitro. Furthermore, the first 20 N-terminal amino acids of BopC were found to be sufficient to mediate the T3SS-dependent translocation of a reporter protein from a heterologous enteropathogenic Escherichia coli host into mammalian cells.

Moreover, neither pks1 nor pks-nrps1 contains the previously reported 232-bp KS-domain fragment cloned from Selleck MS-275 C. militaris 5050 (Lee et al., 2001).

These findings indicate that C. militaris and related species represent a rich reservoir of novel secondary metabolites. Further exploration of these genes and yet undescribed genes may greatly improve our understanding of the life history of these fungi and the richness of their secondary metabolites. This work was supported by the MPG-CAS Joint Doctoral Promotion Program (DPP) and the National Natural Science Foundation of China (31170017). We thank D. Spiteller for providing the DSM 1153 strain, laboratory assistance, and helpful discussions. We also thank G. Li, H. Guo and A. Jia for laboratory assistance and C. Wang for helpful discussions. Special thanks are owed to the anonymous reviewers for their valuable comments and suggestions. Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author Antiinfection Compound Library datasheet for the article. Fig. S1. The reduced nicotinamide adenine dinucleotide phosphate (NADPH)-binding motifs in active and inactive ER domains. Fig. S2. The chemical profiles of extracts from two Cordyceps militaris strains revealed by high-pressure liquid

chromatography coupled with mass spectrometry. Table S1. Primers used in this study. Table S2. ITS sequences used for the phylogenetic analysis. Table S3. Comparison of the eight amino acid signature sequences in the binding pockets of the A domain of NRPSs, as predicted by NRPS Prediction blast Server, and their known substrates.

“
“Burkholderia pseudomallei, the causative agent of melioidosis, exploits the Bsa type III secretion system (T3SS) to deliver effector proteins into host cells. These effectors manipulate host cell functions; thus, contributing to the ability of the bacteria to evade the immune response and cause disease. Only two Bsa-secreted effectors Atezolizumab have been conclusively identified to date. Here, we report the identification of the third B. pseudomallei type III secreted effector protein, designated BopC. BopC is encoded by the bpss1516 gene abutting bpss1517, which encodes its putative chaperone. The genes are located in the close proximity to the bsa T3SS gene cluster of B. pseudomalleiK96243 (Fig. 1). BopC was secreted into culture supernatant by the wild-type B. pseudomallei strain, but its secretion was abolished in the bsaZ T3SS mutant. Using pull down and co-purification assays, we confirmed that BopC interacts with its putative chaperone, BPSS1517, in vitro. Furthermore, the first 20 N-terminal amino acids of BopC were found to be sufficient to mediate the T3SS-dependent translocation of a reporter protein from a heterologous enteropathogenic Escherichia coli host into mammalian cells.