rubrum whereas in R. centenum a gene encoding a protein

of unknown function present between these two genes. Thus, a conserved gene order of argC-gca1 and relatively short intergenic distance in A. brasilense and phylogenetically close members suggested that these two adjacent codirectional genes might comprise a bicistronic operon and also the possibility of functional and/or regulatory relationship between the two genes. The synteny with regard to the two other ORFs encoding 30 S and 50 S ribosomal subunit proteins, respectively, located upstream of the argC gene was observed in A. brasilense as well as in G. bethesdensis and R. centenum but not in other closely related bacteria. Confirmation of the transcriptional linkage of the argC-gca1

ORFs To determine if argC and gca1 genes are part of a single operon and transcribed as a single mRNA, reverse transcription-PCR (RT-PCR) experiments were performed using total SBE-��-CD purchase selleck chemical RNA isolated from A. brasilense cultures using three different primer sets, (Table 1 and Figure 5C) gcaF1/gcaR1 to amplify gca1 ORF (519 bp), argF/argR1 for 687 bp portion of argC ORF and argF1/gcaR3 to amplify the transcript (625 bp) encompassing both argC and gca1 ORFs. Analysis of RT-PCR amplified product revealed that argF1/gcaR3 primer set produced a fragment of expected size (ca. 600) indicating that there was a single mRNA for these two genes. Amplicons of expected size, ca 700 bp and ca 500 bp, were also obtained

with argC and gca1-specific primer sets, respectively (Figure 5A). RT-PCR analysis confirmed that these genes are, in fact, co-transcribed which Epacadostat suggests a new functional linkage between the two genes that may have interesting implications Dipeptidyl peptidase for A. brasilense physiology. Table 1 Primers used in this study (restriction sites are shown by underlined sequences) Primers Sequence (in 5′ to 3′ direction) gcaF GGAATTC CAT ATGTCCGGCCTGATATTGCCC gcaR CG GGATCC TTAGCCTTCTCTGTAGATTTGAG gcAF AAA CTGCAG ATACGCCACCTGGTACGGGCATG gcAR GA AGATCTGATGAAGCAGCCGCCCTCCAGC gcBF GA AGATCT GGACGGTGCCTACGTCGAGTCG gcBR G GAATTC GAAGTTCGTGCTGGCGGCCTC gcaPrF CGG GGTACC AGCAGCAGAATCTCTTCACC gcaPrR AAA AGGCCT GTCACGGGAACAGCGGAG argPrF CGG GGTACCGAAGTGGTCGCCCCGAAG argPrR AAA AGGCCTGACGCACGGGGATGGGC gcaF1 ATGTCCGGCCTGATATTGC gcaR1 TTAGCCTTCTCTGTAGATTTG gcaR2 CCATGTGACCGATCGACAC gcaR3 CACCGATTCGGATCTCGTTCAC argF ATGGCCAACAGCACTTCCC argF1 GTGACGGTCAGCTTCACG argR1 CATGCGGACGTAGATCGTC argR2 CTCGATCATCTCATCCATCAGCAG Figure 5 Determination of argC / gca1 transcription unit and transcription start site of argC/gca1 transcript. A. Agarose gel showing amplified products obtained by reverse transcriptasepolymerase chain reaction (RT-PCR) with total RNA isolated from Azospirillum brasilense Sp7 using argF/argR1 (Lane 3), gcaF1/gcaR1 (Lane 4) and argF1/gcaR3 (Lane 5) primer sets. Lane 1 and 2 shows the bands of 100 bp DNA ladder (NEB) and control without reverse transcriptase, respectively; B.